Copyright: © 2023 by the authors. Licensee: Pirogov University.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (CC BY).

ORIGINAL RESEARCH

ATOH1 factor expression induces rapid differentiation of iPSCs into neurons

Stepanov AI1,2 , Putlyaeva LV1,2 , Didych DA2 , Galiakberova AA3,4 , Gurskaya NG1,3 , Lukyanov KA2
About authors

1 Skolkovo Institute of Science and Technology, Center for Molecular and Cellular Biology, Moscow, Russia

2 Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Moscow, Russia

3 Pirogov Russian National Research Medical University, Moscow, Russia

4 Lomonosov Moscow State University, Moscow, Russia

Correspondence should be addressed: Nadezhda G. Gurskaya
Ostrovitianova, 1, str. 1, Moscow, 117997, Russia; ur.liam@ayaksrugn

About paper

Funding: the study was supported through the grant by RSF (№ 22-14-00141).

Author contribution: Stepanov AI — experimental procedure; Putlyaeva LV — experiment planning, manuscript writing; Didych DA — design and molecular cloning of the leniviral plasmid components, processing of figures; Galiakberova AA — cell culture; Gurskaya NG — concept and design of iPSC study; Lukyanov KA — general management.

Received: 2023-08-01 Accepted: 2023-09-09 Published online: 2023-09-22
|

Human induced pluripotent stem cells (iPSCs) were first obtained in 2007 [1]. iPSCs, that are similar to embryonic stem cells, can differentiate into various cell types. Since iPSCs can be obtained from the easily accessible patients’ somatic cells (for example, dermal fibroblasts or peripheral blood mononuclear cells), the use of iPSCs solves important methodological and ethical problems, such as the problem of the neuronal cells’ accessibility. iPSCs represent an extremely interesting model for fundamental studies of the human cells’ differentiation and dedifferentiation, these cells are also of considerable practical relevance for medicine. Human iPSCs can be used to generate cells of various types and potentially for further transplantation in patients [2]. Many problems on the way to this (such as incomplete differentiation of human iPSCs and the development of teratomas) remain to be resolved and require further research. Testing of drugs on human cells, including in order to select the treatment regimen for individual patient (personalized medicine), is an equally important area of using iPSCs [3, 4]. Researchers can use iPSCs of patients generated from somatic cells to obtain isogenic cell lines, in which the disease patterns are reproduced, through differentiation and use these cell lines for drug screening. Thus, iPSCs of patients after their differentiation into neurons or glial cells are used to study neurodegenerative diseases [5, 6].  

Differentiation of iPSCs into neurons can be accomplished by using methods of two groups: 1) chemical induction; 2) genetically mediated induction [7]. In the first case, the mixture of small-molecule inhibitors and peptides suppressing the expression of pro-neuronal growth factors, as well as molecular pathways inducing neuronal induction are used to trigger differentiation. Dual SMAD inhibition is a well-known example [8]. The genetically mediated induction is aimed to introduce cDNAs encoding the gene of the transcription factor specific for the neuronal differentiation program (such as neurogenin-2) or regulatory sequences, such as promoters or enhancers, into the cell [9]. However, both strategies make it possible to ensure iPSC differentiation into neurons in at least two weeks.

In 2021, a groundbreaking report was published, where the authors proposed a new method for directed differentiation of iPSCs into neurons using the ATOH1 transcription factor overexpression [10]. The new approach is superior to earlier applied methods in terms of speed and simplicity, it allows one to ensure differentiation (up to 99%) in the standard medium within just a few days.

The study was aimed to generate an iPSC line carrying the gene encoding the ATOH1 transcription factor controlled by the Tet-One expression induction system and the TagBFP2 fluorescent protein as a selective marker. One of the objectives was to obtain a stable iPSC line allowing one to induce differentiation into neurons by adding doxycycline to the growth medium. This cell line can be used in various studies, including for analysis of the iPSC intercellular heterogeneity, development of the genetically encoded fluorescent sensors, testing of new drugs on human cells, and selection of treatment regimens for individual patients (development of personalized medicine protocols). 

METHODS

Molecular cloning

The ATOH1 transcription factor nucleotide sequence was amplified from the Addgene pTet-O-ATOH1-T2A-PuroR plasmid (Addgene #162342) using the ATOH1 for ATATGAAGACTTGATCATGTCCCGCCTGCTGCATGCAGAAGAG and ATOH1 rev ATATGAAGACAAACCTCTAGAACTTGCCTCATCCGAGTCACT GTAATGGGAATG primers. Then ATOH1 and TagBFP2 were inserted in the pRRLSIN.cPPT.EF1 lentiviral vectors at the BamH1 and EcoR1 (Thermo Scientific, Waltham, MA; USA) restriction sites. The following primers were used for TagBFP2 amplification: TagBFP2 for ATATGAAGACGGAGGTGTGAGCGAGCTGATTAAGGAGAACATGC and TagBFP2 rev GCATGAAGACATTCGATCATCACTTGTGCCCCAGTTTGCTAGGGAGGTC GCAGTATCTGGCC. The ATOH1 and TagBFP2 fusion was by using the T2A GSGEGRGSLLTCGDVEENPGP proteolytically cleaved peptide. The pRRLSIN.cPPT.EF1 lentiviral vector was kindly provided by Dr. D. Trono (Lausanne; Switzerland). Then the ATOH1-t2a-TagBFP2 DNA was transferred to the pLVXTetOne-Puro vector (Clontech, #631847; USA) at the BamH1 and Age1 restriction sites (Thermo Scientific, Waltham, MA; PanEco; Russia). The Т4 DNA ligase (Evrogen; Russia) was used for sticky end ligation.

Cell line cultivation

The HEK293T cells were cultured at 37 °C (5% CO2) in the DMEM medium (PanEco; Russia) supplemented with 10% fetal bovine serum (BioSera, Nuaille; France), 100 U/mL of penicillin and 100 mg/mL of streptomycin (PanEco; Russia).

The iPS-KYOU iPSC cell line was purchased at the ATCC cell bank (KYOU-DXR0109B, ATCC® ACS-1023™). iPSCs were cultured in the mTeSR medium (StemCell Technologies; USA) at 37 °C (5% CO2) changed daily to ensure optimal growth and Matrigel (Corning; USA) as a matrix for the surface cover. Accutase (StemCell Technologies; USA) was used to detach cells from the flask surface.

Generating a stable cell line

The TetOne-ATOH1-t2a-TagBFP2 iPSC cell line was generated by lentiviral transduction. A total of 1.5 × 106 HEK293T cells were seeded on a cell culture dish with a diameter of 60 mm 24 h before transfection. In total, 2 µg of the pR8.91 plasmid, 0.6 µg of the pMD.G plasmid, and 6 µg of the TetOneATOH1-t2a-TagBFP2 plasmid were used for transfection. The Transfectin reagent (IBCh RAS; Moscow, Russia) in the ratio 2.5 µL of the reagent to 1µg of the plasmid was used for transient transfection of the HEK293T cells. The mixture of DNA and Transfectin was incubated for 20 min at room temperature and then added dropwise. After 4 h the medium was replaced with 2 mL of fresh DMEM. On the next day the medium containing the lentiviruses acquired was filtered (filter with the pore size of 0.45 µm) and concentrated by ultracentrifugation at 100,000 g (Beckman; USA) for 3 h at 4 °С. Precipitate was resuspended in 500 µL of mTeSR (StemCell Technologies; USA) and used for transduction of iPSCs. Lentiviral particles were added to 1 × 105 iPSCs to generate stable cell lines. Then the transduced cells were selected by adding the puromycin antibiotic (Thermo Fisher Scientific, Waltham, MA; USA) to the growth medium to a final concentration of 5 µg/mL.

Immunostaining of fixed cells

Cells were seeded and grown as described above, fixed in 4% formaldehyde solution in PBS for 15 min at room temperature, triple washed with PBS, permeabilized for 20 min in 0.1% Triton X-100 (Helicon; USA) in PBS, and incubated for 1 h with 1% BSA (Sigma; USA) in PBS to ensure blocking. Incubation with primary antibody was performed for 1 h, incubation with secondary antibody was performed for 1 h at room temperature. Cells were washed with PBS and imaged in the imaging medium using the BZ-9000 microscope (Keyence, Osaka; Japan). The rabbit anti-TUBB3 and goat anti-rabbit IgG Alexa Fluor 568 antibodies (ThermoFisher, Waltham, MA; USA) were used at a dilution of 1 : 500 and 1 : 1000, respectively.

Fluorescence microscopy of living cells

When conducting experiments on living cell imaging, cells were grown in confocal dishes with glass bottom (SPL Life Sciences; Korea). The mTESR medium was replaced with the MEM imaging medium (PanEco; Russia) supplemented with 10% fetal bovine serum (BioSera, Cholet; France) and 20 mM HEPES (Corning, NY; USA) immediately before microscopy.

The Keyence Biorevo BZ-9000 fluorescence microscope (Keyence; Japan) was used for in vivo fluorescence microscopy. Cells were imaged at 60× magnification using the CFI Plan Apo λ60xH/NA1.40 lens. Imaging was performed in the blue channel using the DAPI filter cube (excitation wavelength 360/40 nm, emission wavelength 460/50 nm) for detection of the TagBFP2 fluorescence.

RESULTS

When constructing the most effective model of inducing iPSC differentiation into neurons, we used the approach reported by the group of G. Church in 2021 [10]. In this study a largescale screening of three human iPSC lines was performed; it was found that the ATOH1 transcription factor was the most effective driver of the neuronal differentiation induction. In contrast to other pathways of iPSC differentiation into neurons, the ATOH1-induced differentiation requires no specific media or extra factors. Furthermore, this process takes little time (4 days). To create the most biologically relevant model of the ATOH1induced neuronal differentiation, we decided to construct a stable iPSC line carrying the ATOH1 gene controlled by under the control of the TRE3Gs inducible promoter. For that we made a lentiviral plasmid with induced ATOH1 expression (fig. 1). This plasmid comprised three independent expression cassettes:

TRE3G promoter-ATOH1-t2a-TagBFP2 — the АТОН1 gene controlled by the tetracycline promoter and fused with the expression marker, the fluorescent protein TagBFP2, through the T2A peptide. Induction of ATOH1-t2a-TagBFP2 expression was achieved by adding doxycycline to the growth medium.

hPGK promoter-TetOn3G — TetOn3G, the gene encoding the TetOn tetracycline promoter activator, was controlled by the hPGK promoter;

SV40 promoter-PuroR — ensured puromycin expression that was essential for selection of iPSCs carrying a target construct only.

 This genetic construct referred to as TetOne-ATOH1-t2aTagBFP2 was used to generate lentiviral particles and infect the iPS-KYOU cell line (fig. 2А). After that the cells were subjected to selection in the puromycin-containing medium, then doxycycline was added for the tetracycline promoter activation. Within 24 h after adding doxycycline we recorded weak fluorescence of the TagBFP2 blue protein, indicating the earliest stage of the ATOH1 factor expression. On day two the signal was strong and well-detectable for the fluorescence microscope, the neuron-like cell morphology changes were reported (fig. 2B; above).

Differentiation efficiency was assessed by immunofluorescence staining aimed at detecting the neuronal stem cell marker (class III β-tubulin, TUBB3) expression (fig. 3А). We showed that the cell culture obtained after differentiation was heterogeneous in terms of TUBB3 expression: some cells showing TagBFP2 fluorescence did not express TUBB3 and had no morphological features specific for neurons (fig. 3B).

The findings suggest that the TetOne-ATOH1-t2a-TagBFP2 human iPSC line shows stable ATOH1 transcription factor expression controlled by the TetOne expression induction system. The use of this cell line in laboratory studies can provide unique information about the chromatin state changes during iPSC differentiation into neurons. This biological model can potentially be used to address diverse biological and biomedical challenges.

DISCUSSION

The generated TetOne-ATOH1-t2a-TagBFP2 cell line showed successful inducible expression activation within 1–2 days after the start of the experiment. However, the expression of blue protein reflecting the ATOH1 protein levels in the cell was heterogeneous (fig. 2B, below; fig. 3B). Perhaps, this phenomenon was due to heterogeneity of original iPSC line and no clonal selection among transduced cells in this experiment. We also assume that methylation of the tetracycline promoter and/or hPGK promoter can occur in iPSCs over time, resulting in the decrease in the tetracycline promoter activator protein levels. The ATOH1-t2a-TagBFP2 downregulation represents a cumulative effect of these processes.  Indeed, we have found out that the number of cells showing the TagBFP2 expression has reduced after thawing a new aliquot of TetOne-ATOH1t2a-TagBFP2 cells and repeating the experiment (fig. 2C).

CONCLUSIONS

The use of the new method of directed iPSC differentiation into neurons makes it possible to quickly (in 4 days) generate the populations enriched with cells that differentiate into neurons. The cell line generated showing ATOH1 expression controlled by the TRE3Gs inducible promoter is suitable for experiments requiring rapid iPSC differentiation, however, the experiment has to be carried out continuously (with no freezing/thawing cycles), which represents a limitation of this method when used to acquire experimental data.

КОММЕНТАРИИ (0)